BLAST Results

Your search parameters were adjusted to search for a short input sequence.

Edit and Resubmit [Sign in above to save your search strategy] Formatting options Download How to read this page Blast report description

Formatting options
Show	Alignment as Old View Reset form to defaults [?]
Alignment View	[?]
Display	Graphical Overview Linkout Sequence Retrieval NCBI-gi CDS feature [?]
Masking	Character: Color: [?]
Limit results	Descriptions: Graphical overview: Alignments: Line length: [?]
	Organism Type common name, binomial, taxid, or group name. Only 20 top taxa will be shown. Exclude [?]
	Entrez query: [?]
	Expect Min: Expect Max: [?]
	Percent Identity Min: Percent Identity Max: [?]
Format for	PSI-BLAST with inclusion threshold: [?] Format for PSI-BLAST: The Position-Specific Iterated BLAST (PSI-BLAST) program performs iterative searches with a protein query, in which sequences found in one round of search are used to build a custom score model for the next round. more... Inclusion Threshold: This sets the statistical significance threshold for including a sequence in the model used by PSI-BLAST to create the PSSM on the next iteration.

Download
Alignment Text XML ASN.1 JSON Seq-align Hit Table(text) Hit Table(csv) Multiple-file XML2 Single-file XML2 Multiple-file JSON Single-file JSON SAM	Search Strategies ASN.1	PssmWithParameters ASN.1	[?]

The Download link provides BLAST output that may be used as input to another program. This includes parseable formats such as the tabular report or XML as well as the Search Strategy files read by the BLAST+ applications. More details on the parseable (XML, tabular, and ASN.1) reports can be found at https://www.ncbi.nlm.nih.gov/books/NBK153387/

The following formats are offered under the Alignment section:
1). "Text". Non-HTML standard BLAST report.
2). "XML". XML report based upon the DTD at https://www.ncbi.nlm.nih.gov/data_specs/dtd/NCBI_BlastOutput.dtd
3). "ASN.1". Alignment written out in Abstract Syntax Notation 1.
4). "JSON Seq-align". Alignment written out in JSON.
4). "Hit Table(text)". The tabular report as text.
5). "Hit Table(csv)". The tabular report ready for import into spread-sheet programs like Excel.
6). "XML2". New XML format described at ftp://ftp.ncbi.nlm.nih.gov/blast/documents/NEWXML/xml2.pdf.
7). "JSON". New JSON format described at ftp://ftp.ncbi.nlm.nih.gov/blast/documents/NEWXML/xml2.pdf.
8). "SAM". Sequence Alignment Map format.

XML2 and JSON can be downloaded either as one file per query (multiple-file) or one file for all queries (single-file). These formats are listed as Multiple-file XML2 (and JSON) or Single-file XML (and JSON).

The following report is offered under the Search Strategy section:
1). "ASN.1" Search Strategy. A record of the parameters, query, and database used in the search. This file can be used to start a stand-alone BLAST search, see https://www.ncbi.nlm.nih.gov/books/NBK1763/#CmdLineAppsManual.I455_BLAST_search_stra

THAP1_humaine

RID: Z44104HS015 (Expires on 10-04 16:00 pm)

Query ID: lcl|Query_160889; lcl|Query_160889
Description: THAP1_humaine
Molecule type: nucleic acid
Query Length: 27


Database Name: Mouse G+T (2 databases)
Description: See details
Program: BLASTN 2.5.0+ Citation

Blast search databases information
Database	Description	Posted Date
GPIPE/10090/current/all_top_level	Mus musculus GRCm38.p4 [GCF_000001635.24] chromosomes plus unplaced and unlocalized scaffolds (reference assembly in Annotation Release 106)	Jun 22, 2016 3:07 PM
GPIPE/10090/current/rna	Mus musculus Annotation Release 106 RNAs	Jun 22, 2016 3:07 PM

Other reports: Search Summary [Distance tree of results] [Genome view]

Search Parameters
Search parameter name	Search parameter value
Program	blastn
Word size	7
Expect value	1000
Hitlist size	100
Match/Mismatch scores	1,-3
Gapcosts	5,2
Filter string	F
Genetic Code	1

Database
Database parameter name	Database parameter value
Posted date	Jun 22, 2016 3:07 PM
Number of letters	3,164,670,549
Number of sequences	107,382
Entrez query	none

Karlin-Altschul statistics
Params	Ungapped	Gapped
Lambda	1.37406	1.37406
K	0.710603	0.710603
H	1.30725	1.30725

Results Statistics
Results Statistics parameter name	Results Statistics parameter value
Length adjustment	18
Effective length of query	9
Effective length of database	3162737673
Effective search space	28464639057
Effective search space used	28464639057

Descriptions

, AlignDB=on Reading indexes 1-5, displaying indexes 1-5

Sequences producing significant alignments:

Select:All None Selected:0

Sequences producing significant alignments:
Select for downloading or viewing reports	Description	Max score	Total score	Query cover	E value	Ident	Accession
Transcripts
1 Select seq ref\|NM_199042.2\|	Mus musculus THAP domain containing, apoptosis associated protein 1 (Thap1), mRNA	54.0	54.0	100%	2e-06	100%	NM_199042.2
2 Select seq ref\|XR_383160.3\|	PREDICTED: Mus musculus choline dehydrogenase (Chdh), transcript variant X1, misc_RNA	32.2	32.2	59%	5.7	100%	XR_383160.3
3 Select seq ref\|NM_001136240.1\|	Mus musculus choline dehydrogenase (Chdh), transcript variant 1, mRNA	32.2	32.2	59%	5.7	100%	NM_001136240.1
4 Select seq ref\|NM_172264.2\|	Mus musculus choline dehydrogenase (Chdh), transcript variant 3, mRNA	32.2	32.2	59%	5.7	100%	NM_172264.2
5 Select seq ref\|NM_175343.5\|	Mus musculus choline dehydrogenase (Chdh), transcript variant 2, mRNA	32.2	32.2	59%	5.7	100%	NM_175343.5
6 Select seq ref\|XM_006501055.3\|	PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), transcript variant X8, mRNA	30.2	30.2	55%	23	100%	XM_006501055.3
7 Select seq ref\|XM_006501054.3\|	PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), transcript variant X7, mRNA	30.2	30.2	55%	23	100%	XM_006501054.3
8 Select seq ref\|XM_006501053.3\|	PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), transcript variant X6, mRNA	30.2	30.2	55%	23	100%	XM_006501053.3
9 Select seq ref\|XM_006501052.3\|	PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), transcript variant X5, mRNA	30.2	30.2	55%	23	100%	XM_006501052.3
10 Select seq ref\|XM_006501051.3\|	PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), transcript variant X4, mRNA	30.2	30.2	55%	23	100%	XM_006501051.3
11 Select seq ref\|XM_006501050.3\|	PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), transcript variant X3, mRNA	30.2	30.2	55%	23	100%	XM_006501050.3
12 Select seq ref\|XM_006501049.3\|	PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), transcript variant X2, mRNA	30.2	30.2	55%	23	100%	XM_006501049.3
13 Select seq ref\|XM_006501048.3\|	PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), transcript variant X1, mRNA	30.2	30.2	55%	23	100%	XM_006501048.3
14 Select seq ref\|NM_008417.5\|	Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), mRNA	30.2	30.2	55%	23	100%	NM_008417.5
15 Select seq ref\|XM_011239687.2\|	PREDICTED: Mus musculus synapse differentiation inducing 1 (Syndig1), transcript variant X3, mRNA	28.2	28.2	51%	89	100%	XM_011239687.2
16 Select seq ref\|XM_006499874.3\|	PREDICTED: Mus musculus synapse differentiation inducing 1 (Syndig1), transcript variant X1, mRNA	28.2	28.2	51%	89	100%	XM_006499874.3
17 Select seq ref\|XM_017315889.1\|	PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X8, mRNA	28.2	28.2	51%	89	100%	XM_017315889.1
18 Select seq ref\|XM_011244971.2\|	PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X7, mRNA	28.2	28.2	51%	89	100%	XM_011244971.2
19 Select seq ref\|XM_006518625.3\|	PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X6, mRNA	28.2	28.2	51%	89	100%	XM_006518625.3
20 Select seq ref\|XM_011244970.2\|	PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X5, mRNA	28.2	28.2	51%	89	100%	XM_011244970.2
21 Select seq ref\|XM_011244969.2\|	PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X4, mRNA	28.2	28.2	51%	89	100%	XM_011244969.2
22 Select seq ref\|XM_011244968.2\|	PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X3, mRNA	28.2	28.2	51%	89	100%	XM_011244968.2
23 Select seq ref\|XM_006518624.3\|	PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X2, mRNA	28.2	28.2	51%	89	100%	XM_006518624.3
24 Select seq ref\|XM_006518623.3\|	PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X1, mRNA	28.2	28.2	51%	89	100%	XM_006518623.3
25 Select seq ref\|XM_011241479.1\|	PREDICTED: Mus musculus zinc finger protein 248 (Zfp248), transcript variant X2, mRNA	28.2	28.2	51%	89	100%	XM_011241479.1
26 Select seq ref\|NM_028335.2\|	Mus musculus zinc finger protein 248 (Zfp248), mRNA	28.2	28.2	51%	89	100%	NM_028335.2
27 Select seq ref\|NM_010636.3\|	Mus musculus Kruppel-like factor 12 (Klf12), mRNA	28.2	28.2	51%	89	100%	NM_010636.3
28 Select seq ref\|XR_001783506.1\|	PREDICTED: Mus musculus predicted gene 14133 (Gm14133), transcript variant X1, ncRNA	28.2	28.2	51%	89	100%	XR_001783506.1
29 Select seq ref\|XM_017317634.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X16, mRNA	28.2	28.2	51%	89	100%	XM_017317634.1
30 Select seq ref\|XM_017317632.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X15, mRNA	28.2	28.2	51%	89	100%	XM_017317632.1
31 Select seq ref\|XM_017317630.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X14, mRNA	28.2	28.2	51%	89	100%	XM_017317630.1
32 Select seq ref\|XM_017317629.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X13, mRNA	28.2	28.2	51%	89	100%	XM_017317629.1
33 Select seq ref\|XM_017317628.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X12, mRNA	28.2	28.2	51%	89	100%	XM_017317628.1
34 Select seq ref\|XM_017317627.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X11, mRNA	28.2	28.2	51%	89	100%	XM_017317627.1
35 Select seq ref\|XM_017317626.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X10, mRNA	28.2	28.2	51%	89	100%	XM_017317626.1
36 Select seq ref\|XM_017317625.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X9, mRNA	28.2	28.2	51%	89	100%	XM_017317625.1
37 Select seq ref\|XM_017317624.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X8, mRNA	28.2	28.2	51%	89	100%	XM_017317624.1
38 Select seq ref\|XM_017317623.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X7, mRNA	28.2	28.2	51%	89	100%	XM_017317623.1
39 Select seq ref\|XM_017317621.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X6, mRNA	28.2	28.2	51%	89	100%	XM_017317621.1
40 Select seq ref\|XM_017317620.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X5, mRNA	28.2	28.2	51%	89	100%	XM_017317620.1
41 Select seq ref\|XM_017317619.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X4, mRNA	28.2	28.2	51%	89	100%	XM_017317619.1
42 Select seq ref\|XR_001782107.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X3, misc_RNA	28.2	28.2	51%	89	100%	XR_001782107.1
43 Select seq ref\|XR_001782106.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X2, misc_RNA	28.2	28.2	51%	89	100%	XR_001782106.1
44 Select seq ref\|XR_001782105.1\|	PREDICTED: Mus musculus MAP-kinase activating death domain (Madd), transcript variant X1, misc_RNA	28.2	28.2	51%	89	100%	XR_001782105.1
45 Select seq ref\|XM_006527140.3\|	PREDICTED: Mus musculus amyloid beta (A4) precursor protein binding, family A, member 1 (Apba1), transcript variant X2, mRNA	28.2	28.2	51%	89	100%	XM_006527140.3
46 Select seq ref\|XM_006527139.3\|	PREDICTED: Mus musculus amyloid beta (A4) precursor protein binding, family A, member 1 (Apba1), transcript variant X1, mRNA	28.2	28.2	51%	89	100%	XM_006527139.3
47 Select seq ref\|NM_013545.3\|	Mus musculus protein tyrosine phosphatase, non-receptor type 6 (Ptpn6), transcript variant 1, mRNA	28.2	28.2	51%	89	100%	NM_013545.3
48 Select seq ref\|NM_007935.2\|	Mus musculus enhancer of polycomb homolog 1 (Drosophila) (Epc1), transcript variant 1, mRNA	28.2	28.2	51%	89	100%	NM_007935.2
49 Select seq ref\|NM_027497.3\|	Mus musculus enhancer of polycomb homolog 1 (Drosophila) (Epc1), transcript variant 2, mRNA	28.2	28.2	51%	89	100%	NM_027497.3
50 Select seq ref\|NM_001177720.1\|	Mus musculus MAP-kinase activating death domain (Madd), transcript variant 11, mRNA	28.2	28.2	51%	89	100%	NM_001177720.1
51 Select seq ref\|NM_001177719.1\|	Mus musculus MAP-kinase activating death domain (Madd), transcript variant 10, mRNA	28.2	28.2	51%	89	100%	NM_001177719.1
52 Select seq ref\|NM_145527.4\|	Mus musculus MAP-kinase activating death domain (Madd), transcript variant 9, mRNA	28.2	28.2	51%	89	100%	NM_145527.4
53 Select seq ref\|NM_020584.2\|	Mus musculus telomeric repeat binding factor 2, interacting protein (Terf2ip), mRNA	28.2	28.2	51%	89	100%	NM_020584.2
54 Select seq ref\|NM_007761.2\|	Mus musculus calcitonin gene-related peptide-receptor component protein (Crcp), mRNA	28.2	28.2	51%	89	100%	NM_007761.2
55 Select seq ref\|NM_177034.3\|	Mus musculus amyloid beta (A4) precursor protein binding, family A, member 1 (Apba1), mRNA	28.2	28.2	51%	89	100%	NM_177034.3
56 Select seq ref\|XR_001782766.1\|	PREDICTED: Mus musculus uncharacterized LOC108168455 (LOC108168455), ncRNA	26.3	26.3	48%	353	100%	XR_001782766.1
57 Select seq ref\|XM_017318394.1\|	PREDICTED: Mus musculus iduronate 2-sulfatase (Ids), transcript variant X3, mRNA	26.3	26.3	48%	353	100%	XM_017318394.1
58 Select seq ref\|XM_017318393.1\|	PREDICTED: Mus musculus iduronate 2-sulfatase (Ids), transcript variant X2, mRNA	26.3	26.3	48%	353	100%	XM_017318393.1
59 Select seq ref\|XM_006512294.3\|	PREDICTED: Mus musculus F-box and leucine-rich repeat protein 2 (Fbxl2), transcript variant X6, mRNA	26.3	26.3	48%	353	100%	XM_006512294.3
60 Select seq ref\|XM_011243028.2\|	PREDICTED: Mus musculus F-box and leucine-rich repeat protein 2 (Fbxl2), transcript variant X5, mRNA	26.3	26.3	48%	353	100%	XM_011243028.2
61 Select seq ref\|XR_379880.3\|	PREDICTED: Mus musculus F-box and leucine-rich repeat protein 2 (Fbxl2), transcript variant X3, misc_RNA	26.3	26.3	48%	353	100%	XR_379880.3
62 Select seq ref\|XR_379878.3\|	PREDICTED: Mus musculus F-box and leucine-rich repeat protein 2 (Fbxl2), transcript variant X1, misc_RNA	26.3	26.3	48%	353	100%	XR_379878.3
63 Select seq ref\|XM_006511935.3\|	PREDICTED: Mus musculus collagen, type VII, alpha 1 (Col7a1), transcript variant X1, mRNA	26.3	26.3	48%	353	100%	XM_006511935.3
64 Select seq ref\|XM_006508353.3\|	PREDICTED: Mus musculus cell migration inducing protein, hyaluronan binding (Cemip), transcript variant X2, mRNA	26.3	26.3	48%	353	100%	XM_006508353.3
65 Select seq ref\|XR_001785144.1\|	PREDICTED: Mus musculus kielin/chordin-like protein (Kcp), transcript variant X7, misc_RNA	26.3	26.3	48%	353	100%	XR_001785144.1
66 Select seq ref\|XR_878688.2\|	PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 (Ddx54), transcript variant X1, misc_RNA	26.3	26.3	48%	353	100%	XR_878688.2
67 Select seq ref\|XR_001784745.1\|	PREDICTED: Mus musculus mesenteric estrogen dependent adipogenesis (Medag), transcript variant X4, misc_RNA	26.3	26.3	48%	353	100%	XR_001784745.1
68 Select seq ref\|XM_006530360.3\|	PREDICTED: Mus musculus predicted gene 15800 (Gm15800), transcript variant X11, mRNA	26.3	26.3	48%	353	100%	XM_006530360.3
69 Select seq ref\|XM_006530359.3\|	PREDICTED: Mus musculus predicted gene 15800 (Gm15800), transcript variant X10, mRNA	26.3	26.3	48%	353	100%	XM_006530359.3
70 Select seq ref\|XM_011248204.2\|	PREDICTED: Mus musculus predicted gene 15800 (Gm15800), transcript variant X9, mRNA	26.3	26.3	48%	353	100%	XM_011248204.2
71 Select seq ref\|XM_006530358.3\|	PREDICTED: Mus musculus predicted gene 15800 (Gm15800), transcript variant X8, mRNA	26.3	26.3	48%	353	100%	XM_006530358.3
72 Select seq ref\|XM_006530357.3\|	PREDICTED: Mus musculus predicted gene 15800 (Gm15800), transcript variant X7, mRNA	26.3	26.3	48%	353	100%	XM_006530357.3
73 Select seq ref\|XM_006530356.3\|	PREDICTED: Mus musculus predicted gene 15800 (Gm15800), transcript variant X6, mRNA	26.3	26.3	48%	353	100%	XM_006530356.3
74 Select seq ref\|XM_006530355.3\|	PREDICTED: Mus musculus predicted gene 15800 (Gm15800), transcript variant X5, mRNA	26.3	26.3	48%	353	100%	XM_006530355.3
75 Select seq ref\|XM_006530354.3\|	PREDICTED: Mus musculus predicted gene 15800 (Gm15800), transcript variant X4, mRNA	26.3	26.3	48%	353	100%	XM_006530354.3
Genomic sequences[show first]
76 Select seq ref\|NC_000074.6\|	Mus musculus strain C57BL/6J chromosome 8, GRCm38.p4 C57BL/6J	54.0	621	100%	2e-06	100%	NC_000074.6
77 Select seq ref\|NT_166299.2\|	Mus musculus strain NOD/MrkTac chromosome 4 genomic contig, GRCm38.p4 alternate locus group NOD/MrkTac MMCHR4_NOD_IDD9_2	42.1	110	77%	0.006	100%	NT_166299.2
78 Select seq ref\|NC_000079.6\|	Mus musculus strain C57BL/6J chromosome 13, GRCm38.p4 C57BL/6J	36.2	633	88%	0.37	100%	NC_000079.6
79 Select seq ref\|NC_000072.6\|	Mus musculus strain C57BL/6J chromosome 6, GRCm38.p4 C57BL/6J	34.2	868	96%	1.4	100%	NC_000072.6
80 Select seq ref\|NC_000080.6\|	Mus musculus strain C57BL/6J chromosome 14, GRCm38.p4 C57BL/6J	32.2	668	96%	5.7	100%	NC_000080.6
81 Select seq ref\|NC_000067.6\|	Mus musculus strain C57BL/6J chromosome 1, GRCm38.p4 C57BL/6J	30.2	1027	100%	23	100%	NC_000067.6
82 Select seq ref\|NC_000068.7\|	Mus musculus strain C57BL/6J chromosome 2, GRCm38.p4 C57BL/6J	30.2	1183	96%	23	100%	NC_000068.7
83 Select seq ref\|NC_000070.6\|	Mus musculus strain C57BL/6J chromosome 4, GRCm38.p4 C57BL/6J	30.2	937	96%	23	100%	NC_000070.6
84 Select seq ref\|NC_000077.6\|	Mus musculus strain C57BL/6J chromosome 11, GRCm38.p4 C57BL/6J	30.2	894	81%	23	100%	NC_000077.6
85 Select seq ref\|NC_000078.6\|	Mus musculus strain C57BL/6J chromosome 12, GRCm38.p4 C57BL/6J	30.2	638	85%	23	100%	NC_000078.6
86 Select seq ref\|NC_000081.6\|	Mus musculus strain C57BL/6J chromosome 15, GRCm38.p4 C57BL/6J	30.2	755	88%	23	100%	NC_000081.6
87 Select seq ref\|NC_000082.6\|	Mus musculus strain C57BL/6J chromosome 16, GRCm38.p4 C57BL/6J	30.2	719	81%	23	100%	NC_000082.6
88 Select seq ref\|NC_000086.7\|	Mus musculus strain C57BL/6J chromosome X, GRCm38.p4 C57BL/6J	30.2	426	70%	23	100%	NC_000086.7
89 Select seq ref\|NC_000069.6\|	Mus musculus strain C57BL/6J chromosome 3, GRCm38.p4 C57BL/6J	30.2	993	96%	23	100%	NC_000069.6
90 Select seq ref\|NC_000073.6\|	Mus musculus strain C57BL/6J chromosome 7, GRCm38.p4 C57BL/6J	30.2	965	88%	23	100%	NC_000073.6
91 Select seq ref\|NC_000075.6\|	Mus musculus strain C57BL/6J chromosome 9, GRCm38.p4 C57BL/6J	30.2	696	88%	23	100%	NC_000075.6
92 Select seq ref\|NC_000076.6\|	Mus musculus strain C57BL/6J chromosome 10, GRCm38.p4 C57BL/6J	30.2	615	92%	23	100%	NC_000076.6
93 Select seq ref\|NT_039296.1\|	Mus musculus strain 129X1/SvJ chromosome 4 genomic contig, GRCm38.p4 alternate locus group 129X1/SvJ 129X1/SVJ_MMCHR4_CTG2	30.2	30.2	55%	23	100%	NT_039296.1
94 Select seq ref\|NC_000071.6\|	Mus musculus strain C57BL/6J chromosome 5, GRCm38.p4 C57BL/6J	28.2	1005	96%	89	100%	NC_000071.6
95 Select seq ref\|NC_000084.6\|	Mus musculus strain C57BL/6J chromosome 18, GRCm38.p4 C57BL/6J	28.2	533	85%	89	100%	NC_000084.6
96 Select seq ref\|NC_000085.6\|	Mus musculus strain C57BL/6J chromosome 19, GRCm38.p4 C57BL/6J	28.2	563	88%	89	100%	NC_000085.6
97 Select seq ref\|NT_166293.1\|	Mus musculus strain 129S7/SvEvBrd-Hprt-b-m2 chromosome 4 genomic contig, GRCm38.p4 alternate locus group 129S7/SvEvBrd-Hprt-b-m2 129S7/SVEVBRD-HPRT-B-M2_MMCHR4_CTG2	28.2	28.2	51%	89	100%	NT_166293.1
98 Select seq ref\|NT_080257.1\|	Mus musculus strain 129S1/SvImJ chromosome 3 genomic scaffold, GRCm38.p4 alternate locus group 129S1/SvImJ 129S1/SVIMJ_MMCHR3_CTG4	28.2	28.2	51%	89	100%	NT_080257.1
99 Select seq ref\|NW_012132910.1\|	Mus musculus strain C57BL/6J chromosome 19 genomic patch of type FIX, GRCm38.p4 PATCHES MG4249_PATCH	28.2	28.2	51%	89	100%	NW_012132910.1
100 Select seq ref\|NC_000083.6\|	Mus musculus strain C57BL/6J chromosome 17, GRCm38.p4 C57BL/6J	28.2	343	81%	89	100%	NC_000083.6

Alignments

Download GenBank Graphics Next Previous Descriptions

Mus musculus THAP domain containing, apoptosis associated protein 1 (Thap1), mRNA

Sequence ID: NM_199042.2Length: 2267Number of Matches: 1

Related Information

Gene-associated gene details

GEO Profiles-microarray expression data

Map Viewer-aligned genomic context

Range 1: 283 to 309GenBank Graphics Next Match Previous Match

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
54.0 bits(27)	2e-06()	27/27(100%)	0/27(0%)	Plus/Plus

Query  1    ATGGTGCAGTCCTGCTCCGCCTACGGC  27
            |||||||||||||||||||||||||||
Sbjct  283  ATGGTGCAGTCCTGCTCCGCCTACGGC  309

Download GenBank Graphics Next Previous Descriptions

PREDICTED: Mus musculus choline dehydrogenase (Chdh), transcript variant X1, misc_RNA

Sequence ID: XR_383160.3Length: 4618Number of Matches: 1

Related Information

Range 1: 3040 to 3055GenBank Graphics Next Match Previous Match

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
32.2 bits(16)	5.7()	16/16(100%)	0/16(0%)	Plus/Plus

Query  1     ATGGTGCAGTCCTGCT  16
             ||||||||||||||||
Sbjct  3040  ATGGTGCAGTCCTGCT  3055

Download GenBank Graphics Next Previous Descriptions

Mus musculus choline dehydrogenase (Chdh), transcript variant 1, mRNA

Sequence ID: NM_001136240.1Length: 5652Number of Matches: 1

Related Information

Gene-associated gene details

GEO Profiles-microarray expression data

Map Viewer-aligned genomic context

Range 1: 3970 to 3985GenBank Graphics Next Match Previous Match

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
32.2 bits(16)	5.7()	16/16(100%)	0/16(0%)	Plus/Plus

Query  1     ATGGTGCAGTCCTGCT  16
             ||||||||||||||||
Sbjct  3970  ATGGTGCAGTCCTGCT  3985

Download GenBank Graphics Next Previous Descriptions

Mus musculus choline dehydrogenase (Chdh), transcript variant 3, mRNA

Sequence ID: NM_172264.2Length: 5450Number of Matches: 1

Related Information

Gene-associated gene details

GEO Profiles-microarray expression data

Map Viewer-aligned genomic context

Range 1: 3768 to 3783GenBank Graphics Next Match Previous Match

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
32.2 bits(16)	5.7()	16/16(100%)	0/16(0%)	Plus/Plus

Query  1     ATGGTGCAGTCCTGCT  16
             ||||||||||||||||
Sbjct  3768  ATGGTGCAGTCCTGCT  3783

Download GenBank Graphics Next Previous Descriptions

Mus musculus choline dehydrogenase (Chdh), transcript variant 2, mRNA

Sequence ID: NM_175343.5Length: 5625Number of Matches: 1

Related Information

Gene-associated gene details

GEO Profiles-microarray expression data

Map Viewer-aligned genomic context

Range 1: 3943 to 3958GenBank Graphics Next Match Previous Match

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
32.2 bits(16)	5.7()	16/16(100%)	0/16(0%)	Plus/Plus

Query  1     ATGGTGCAGTCCTGCT  16
             ||||||||||||||||
Sbjct  3943  ATGGTGCAGTCCTGCT  3958

Preferences Turn off

THAP1_humaine

Graphic Summary

Distribution of 200 Blast Hits on the Query Sequence [?]

Descriptions

Alignments